BBa_K1941001 1 BBa_K1941001 scTef1_PP7 2016-10-12T11:00:00Z 2016-10-18T03:11:47Z some source Scaffold that targets TEF1 promoter and recruits the protein repressor module PCP-Mxi via the effector protein recruitments site PP7. PP7 is a well-characterized viral RNA sequence which is recognized by PCP protein. Composed of the Cas9 single guide RNA sequence and the hairpin which interacts with PCP. false false _2408_ 29803 30041 9 false some considerations false Dimitri Coukos BBa_K1941001_sequence 1 ttgatatttaagttaataaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgcaacataaggagtttatatggaaacccttatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z