BBa_K1941005 1 BBa_K1941005 scCyc1_MS2 2016-10-12T11:00:00Z 2016-10-19T07:32:39Z some source! Scaffold RNA that targets the region c3 of CYC1 promoter and recruits the protein repressor module MCP-VP64 via the effector protein recruitments site MS2. MS2 is a well-characterized viral RNA sequence which is recognized by MCP protein. This RNA is composed of the dCas9-binding sgRNA that interacts with CYC1, and the MCP-binding RNA hairpin, MS2. false false _2408_ 29803 30041 9 false some considerations! false Dimitri Coukos BBa_K1941005_sequence 1 cgactactgatgagtccgtgaggacgaaacgagtaagctcgtcgtacatacagtaggatcctagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcgcgcacatgaggatcacccatgtgcttttggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z