BBa_K1947005 1 BBa_K1947005 Spycatcher 2016-10-12T11:00:00Z 2016-10-14T02:27:06Z The sequence of this part comes form NCBI This part encodes a polypeptide that can combined with another specific polypeptide, which is named Spytag, through a covalent bond. In our case this polypeptide will be fused with mms13 and anchoring on the membrane of Magentsome at last. And Spytag will be fused with the recombinant protein that we want to purify. true false _2414_ 33797 34115 9 false In our case this polypeptide will be fused with mms13 and anchoring on the membrane of Magentsome at last. And Spytag will be fused with the recombinant protein that we want to purify. false zhang xucheng BBa_K1947005_sequence 1 atggccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z