BBa_K1949030 1 BBa_K1949030 yafO 2016-10-05T11:00:00Z 2016-10-08T07:23:09Z This part is derived from E.coli,BM26, amplified by using PCR. toxin-antitoxin (TA) systems are cassettes consisting of stable protein, toxin which function as mRNA interferase and unstable protein, antitoxin which destroys function of toxin. Many TA systems exist in the E.coli genome. They can inhibit cell growth or induce cell killing. yafO is one of the toxin and is co-expressed with yafN. 　 false false _2416_ 32067 31979 9 false sequence confirmed. false Yoshio Takata BBa_K1949030_sequence 1 atgcgggtattcaaaacaaaacttattcgcctgcaacttacagcagaggaacttgatgcgttaacggcggattttatttcctataagcgtgacggtgttttgccagatatatttggtcgcgatgcactctacgacgactcctttacctggccattaatcaaatttgagcgagttgctcatattcatctggcaaatgagaataatccatttccgccacagttgcgccaattcagcagaacgaatgacgaagcgcatttggtatattgtcagggggcgtttgatgagcaagcatggttgctcattgccattctgaaacctgaacctcataaactggctcgagataacaaccaaatgcataaaattgggaaaatggcagaagcgtttcgcatgcgtttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z