BBa_K1962001 1 BBa_K1962001 Immunity Protein Im-Ia 2016-10-10T11:00:00Z 2016-10-11T03:07:20Z This part was designed by back-translation of the primary amino acid sequence into DNA sequence, followed by optimisiation for expression in an E. coli chassis. The biobrick was then synthesised de novo by IDT. This biobrick codes for the Immunity Protein for Colicin Ia (<partinfo>BBa_K1962000</partinfo>). Colicin Ia is a channel-forming bacteriocin that depolarizes the cytoplasmic inner membrane of target bacteria, leading to dissipation of cellular energy. This Immunity Protein is tightly linked to its specific Colicin bacteriocin domain to protect the colicinogenic cell from the cytotoxic activity of the colicin. false false _2429_ 8083 8083 9 false Compliant with RFC[10]. false Frank Sargent annotation2491784 1 Immunity Protein Im-Ia range2491784 1 1 333 BBa_K1962001_sequence 1 atgaaccgtaaatactacttcaacaacatgtggtggggttgggttaccggtggttacatgctgtacatgtcttgggactacgagttcaaataccgtctgctgttctggtgcatctctctgtgcggtatggttctgtacccggttgcgaaatggtacatcgaagacaccgcgctgaaattcacccgtccggacttctggaactctggtttcttcgcggacaccccgggtaaaatgggtctgctggcggtttacaccggtaccgttttcatcctgtctctgccgctgtctatgatctacatcctgtctgttatcatcaaacgtctgtctgttcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z