BBa_K1962005 1 BBa_K1962005 Immunity Protein Im-E9 2016-10-10T11:00:00Z 2016-10-11T06:50:23Z The primary protein sequence was obtained from Uniprot and then back-translated into DNA before being codon optimised for E. coli K-12. The resultant biobrick was synthesised in its entirety by IDT as a gBlock gene fragment. This biobrick codes for the Immunity Protein that is specific for Colicin E9. This protein is able to protect a host bacterial cell against attack by Colicin E9 since it binds tightly and specifically to the DNase domain of E9 and inhibits its bactericidal activity. false false _2429_ 8083 8083 9 false Compliant with RFC[10]. false Frank Sargent annotation2491945 1 Immunity Protein Im-E9 range2491945 1 1 258 BBa_K1962005_sequence 1 atggaactgaaacactctatctctgactacaccgaagcggagttcttacaactggttaccaccatctgcaacgcggacacctcttctgaagaagaactggttaaactggttacccacttcgaagaaatgaccgaacacccgtctggttctgacctgatctactacccgaaagaaggtgacgacgactctccgtctggtatcgttaacaccgttaaacagtggcgtgcggcgaacggtaaatctggtttcaaacagggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z