BBa_K1962009 1 BBa_K1962009 Transcriptional Activator RamA 2016-10-11T11:00:00Z 2016-10-12T12:19:09Z This sequence was codon optmised for E. coli and synthesised as a gBlock by IDT. This biobrick encodes RamA from <i>Salmonella enterica</i> ??? it is a member of the AraC family of transcriptional regulators. The RamA protei binds to cholic acid (a constituent of bile salts). It is required for initiation of transcription of the <i>acrRA</i> promoter, which is available as a biobrick <partinfo>BBa_K318514</partinfo> designed by the Wisconsin-Madison iGEM team in 2010. false false _2429_ 8083 8083 9 false Compliant with RFC[10]. false Frank Sargent annotation2493269 1 RamA range2493269 1 1 339 BBa_K1962009_sequence 1 atgaccatctctgcgcaggttatcgacaccatcgttgaatggatcgacgacaacctgaaccagccgctgcgtatcgacgacatcgcgcgtcacgcgggttactctaaatggcacctccagcgtctgttcatgcagtacaaaggtgaatctctgggtcgttacgttcgtgaacgtaaactgaaactggcggcgcgtgacctgctggacaccgaccagaaagtttacgacatctgcctgaaatacggtttcgactctcagcagaccttcacccgtatcttcacccgtaccttcaacctgccgccgggtgcgtaccgtaaagaaaaacacggtcgtacccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z