BBa_K1968007 1 P-45 P-45 Promoter Phytobrick 2016-10-11T11:00:00Z 2016-10-19T03:02:30Z This part was extracted through PCR from pSRKBB-empty vector (Addgene #59449) and was assembled into the PhytoBricks Universal Acceptor (BBa_P10500 or pUPD2). The sequence of this part was confirmed by Sanger Sequencing. A widely used strong constitutive promoter from Corynebacterium (Patek et al., 1996) that works with related gram positive actinobacteria, such as Rhodococcus. We have this part in pUPD2, a MoClo-compatible level 0 vector with no illegal sites for MoClo assembly standard, GoldenBraid assembly standard and iGEM???s pairwise assembly standard. false false _2435_ 30015 30015 9 false The part was integrated in reverse and we advise the user to use the reverse complement sequence for downstream applications. false Ibrahim Al-Masoud annotation2495210 1 P-45 Promoter range2495210 1 5 150 annotation2495206 1 Phytobrick Adapter Site A range2495206 1 1 4 annotation2495208 1 Phytobrick Adapter SiteB range2495208 1 151 154 BBa_K1968007_sequence 1 agtagcgaaacgatcctcatcctgtctcttgatcctgtgcccgctgaacttcttcgtcacttactttagcaaaattagtgcccttcgggaaaaaatccctgaccaatccattcgtattctcattcgacccacgctgccacggcgaatgagctcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z