BBa_K1974033 1 BBa_K1974033 T7 Promoter+RBS+Hv1a+GS linker+snowdrop-lectin+linker+6X His-Tag 2016-10-12T11:00:00Z 2017-03-28T10:01:59Z Artificial Synthesis well false false _2441_ 30645 30645 9 true well false YU-CHUN WU component2532936 1 BBa_B0034 component2532939 1 BBa_K1223006 component2532934 1 BBa_I712074 annotation2532939 1 BBa_K1223006 range2532939 1 75 101 annotation2532934 1 BBa_I712074 range2532934 1 1 46 annotation2532936 1 BBa_B0034 range2532936 1 55 66 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K1223006 1 BBa_K1223006 His-Tag 2013-09-06T11:00:00Z 2015-05-08T01:09:43Z synthetic c-term His tag for purification and identification of protein of interest. false false _1537_ 0 18143 9 It's complicated false purification and identification of protein of interest. false Orr Schlesinger annotation2335270 1 6X His-Tag range2335270 1 1 24 annotation2335271 1 stop codon range2335271 1 25 27 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1223006_sequence 1 gtgcaccaccaccaccatcacgtgtaa BBa_K1974033_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaatactagaggtgcaccaccaccaccatcacgtgtaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z