BBa_K1976023 1 BBa_K1976023 OMT tRNA 2016-10-12T11:00:00Z 2016-10-13T07:39:53Z Methanocaldococcus jannaschii (optimized via directed evolution) OMT tRNA false false _2443_ 30994 30994 9 false Synthesis feasible by IDT, no amber stop codon for termination false Patrick Kunzmann annotation2497698 1 proK Terminator range2497698 1 140 174 annotation2497696 1 proK Promoter range2497696 1 1 62 annotation2497697 1 OMT tRNA range2497697 1 63 139 BBa_K1976023_sequence 1 aggcattttgctattaagggattgacgagggcgtatctgcgcagtaagatgcgccccgcattccggcggtagttcagcagggcagaacggcggactctaaatccgcatggcgctggttcaaatccggcccgccggaccaaattcgaaaagcctgctcaacgagcaggctttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z