BBa_K1994017 1 BBa_K1994017 sgRNA with 5' golden gate adapter and PP7 protein binding site 2016-09-25T11:00:00Z 2016-10-19T01:34:26Z Synthetic For use in CRISPR/Cas9 systems. Contains golden gate adapter at 5' end for inserting target sequence. Contains a PP7 coat protein binding site in the middle. false false _2461_ 30870 27126 9 true No special considerations false Liam Carroll annotation2484944 1 truncated S. pyrogenes terminator range2484944 1 63 96 annotation2484945 1 10bp linker range2484945 1 97 107 annotation2484942 1 20nt golden gate adapter range2484942 1 1 20 annotation2484946 1 PP7 handle range2484946 1 108 139 annotation2484948 1 aspA terminator range2484948 1 150 178 annotation2484947 1 10bp linker range2484947 1 140 150 annotation2484943 1 dCas9 handle range2484943 1 21 62 BBa_K1994017_sequence 1 agagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcacaaaaacataaggagtttatatggaaacccttatgacccaacaagaaaaaaggcacgtcatctgacgtgccttttttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z