BBa_K200012 1 pLambda lambda promoter (cIts responsive) 2009-08-30T11:00:00Z 2015-05-08T01:11:21Z Source organism is bacteriophage lambda. Sequence taken from lysis plasmid pAW12 Released HQ 2013 This common lambda promoter is able to be repressed by temperature sensitive cI protein. <br> This has all 3 operator regions of the lambda promoter, as opposed to only operator region 1 and 2 for the registry promote (BBa_R0051)<br> This promoter is chosen as it has been shown in bacterial lysis experiments <cite>lp1</cite> to be stringently repressed by the temperature sensitive cI protein(BBa_K200011) at temperatures up to 30??C.<br> At temperatures higher than 30??C, the cI857 repressor is denatured and unable to bind to the promoter. As a result, promoter activity is induced. <br> The cI protein-lambda promoter pair provide an effective system for temperature sensitive regulation of gene expression. <br> false false _298_ 0 5055 9 In stock false This was pieced together from 2 oligonucleotides. false Kun Xue annotation2018184 1 OR3 range2018184 1 1 17 annotation2018186 1 OR1 range2018186 1 48 64 annotation2018185 1 OR2 range2018185 1 24 40 BBa_K200012_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z