BBa_K2008002 1 BBa_K2008002 pVeg->sec-TD1-BBI-GFP 2016-10-07T11:00:00Z 2016-10-18T03:13:12Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI). A B. subtilis secretory signal peptide sequence is included to allow for secretion of the peptide directly into surrounding media. A transdermal tag (TD1, BBa_K1074000) is fused to the N-terminus of BBI to allow for diffusion of the peptide across the skin. This construct is fused to GFP (BBa_E0040) for visual detection, and the entire coding sequence is under the control of the constitutive B. subtilis promoter pVeg (BBa_K143012) and a strong B. subtilis RBS (BBa_K780001). Note: This part is a composite part, not a basic part, but it could not be entered as composite at this time. false false _2475_ 30207 30207 9 false Bacillus subtilis-specific components were used (strong RBS and constitutive promoter) to produce high levels of expression of the BBI peptide fused to GFP for visualization. A secretory signal peptide sequence was included to allow for secretion of the peptide directly into surrounding media. A transdermal tag allowed for diffusion of the peptide across the skin. Codons were optimized for B. subtilis. false Rachelle Varga annotation2488494 1 BBI range2488494 1 243 269 annotation2488490 1 BBa_K143012 range2488490 1 1 97 annotation2488493 1 BBa_K1074000 range2488493 1 210 242 annotation2488492 1 Sec tag range2488492 1 126 209 annotation2488497 1 Start codon range2488497 1 123 125 annotation2488496 1 Double stop codon range2488496 1 981 986 annotation2488491 1 BBa_K780001 range2488491 1 98 113 annotation2488495 1 BBa_E0040 range2488495 1 270 980 BBa_K2008002_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtatattaagaggaggagatatatataatgaatatcaagaagttcgcaaaacaggcgacagtcctgacctttaccaccgccctcttggcagggggggcgacccaggcattcgctgcttgttcttcttccccatctaagcattgtggttgcgcactgtcatatccggcacaatgccgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z