BBa_K2008006 1 BBa_K2008006 Xylose->comK with removal of internal restriction sites 2016-10-08T11:00:00Z 2016-10-18T02:34:13Z This part was amplified from the pAX01-comK plasmid constructed by Zhang and Zhang, 2010, and was previously characterized by the UofC_Calgary 2014 iGEM team. This part is an improvement on the comK gene with the intent to make it more accessible to future iGEM teams. Internal restriction enzyme sites (one SpeI site located at base pairs 170-175 and two EcoRI sites located at base pairs 557-562 & 572-577 in the comK part submitted by UofC_Calgary 2014) have been removed. In our version of comK, the SpeI site (ACTAGT) was deleted entirely, as the site was contained within a spacer region between the xylose-inducible promoter and RBS. To remove EcoRI sites, the DNA bases of the new comK construct were changed, and codons were optimized for B. subtilis: 553 A>G 556 C>T 568 A>G 571 C>T As the UofC_Calgary 2014 iGEM team discusses in their comK part (BBa_K1444018), comK is the master transcription factor involved in the competency of B. subtilis. ComK further affects the other competence factors (comC, comE, comF, comG and comK) to increase B. subtilis??? ability to be transformed (van Sinderen et al., 1995). As such, when additional comK is transcribed, it increases B. subtilis transformation efficiency. Also like the UofC_Calgary 2014 iGEM team, we included a xylose-inducible promoter upstream of the comK coding sequence. This allows for induction of competency upon the addition of xylose, which is beneficial as the usual starvation method for transformation of B. subtilis is typically time-consuming and costly. Note: This part is a composite part, not a basic part, but it could not be added as composite at the time of entry. false false _2475_ 30207 30207 9 false Two internal EcoRI restriction sites and one internal SpeI restriction site to allow for this part to be BioBrick compatible. Codons were optimized for B. subtilis. false Rachelle Varga annotation2489297 1 comK range2489297 1 221 793 annotation2489300 1 BBa_B0012 range2489300 1 885 925 annotation2489296 1 Start codon range2489296 1 218 220 annotation2489299 1 BBa_B0010 range2489299 1 797 876 annotation2489298 1 Stop codon range2489298 1 794 796 annotation2489294 1 PxylA range2489294 1 1 155 annotation2489295 1 RBS range2489295 1 203 214 BBa_K2008006_sequence 1 catatctaatattataactaaattttctaaaaaaaacattgaaataaacatttattttgtatatgatgagataaagttagtttattggataaacaaactaactcaattaagatagttgatggataaacttgttcacttaaatcaaagggggaaatgacaaatggtccaagatatctaaaaatcaaagggggaaatgggatccaaaggaggccataatatgagtcagaaaacagacgcacctttagaatcgtatgaagtgaacggcgcaacaattgccgtgctgccagaagaaatagacggcaaaatctgttccaaaattattgaaaaagattgcgtgttttatgtaaacatgaagccgctgcaaattgtcgacagaagctgccgattttttggatcaagctatgcgggaagaaaagcaggaacttatgaagtgacaaaaatttcacacaagccgccgatcatggtggacccttcgaaccaaatctttttattccctacactttcttcgacaagaccccaatgcggctggatttcccatgtgcatgtaaaagagtttaaagcgactgagtttgacgatacggaagtgacgttttccaatgggaaaacgatggagctgccgatctcttataattcgttcgagaaccaggtataccgaacagcgtggctcagaaccaaattccaagacagaatcgaccaccgcgtgccgaaaagacaggaatttatgctgtacccgaaagaagagcggacgaagatgatttatgattttattttgcgtgagctcggggaacggtattagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z