BBa_K2008008 1 BBa_K2008008 pVeg->sec-TD1 modular secretion platform with ThrC homology 2016-10-16T11:00:00Z 2016-10-18T06:46:47Z The pVeg promoter, sec secretion tag as well as the 125-bp AmyE regions of homology B. subtilis genome. TD1 is a transdermal tag first entered into the registry by the USTC_China iGEM team in 2013. This part is meant to be used as a way to integrate any desired insert into the B. subtilis chromosome, which will then be secreted and possess the ability to diffuse transdermally through human skin. The integration cassette contains the constitutive B. subtilis promoter pVeg (BBa_K143012) and a strong B. subtilis RBS (BBa_K780001), as well as a B. subtilis secretory signal peptide sequence to allow for secretion of the desired protein product directly into surrounding media. A transdermal tag (TD1, BBa_K1074000) is included to allow for diffusion of the protein product across the skin. The sequence contains two internal restriction enzyme sites: one for BamHI and one for XmaI. These sites allow for the directional cloning of a desired insert. Note: This part is a composite part, not a basic part, but it could not be added as composite at the time of entry. false false _2475_ 30207 30207 9 true Addition of the AmyE homology regions are derived from B. subtilis 168 genomic DNA. Internal BamHI and XmaI restriction sites are present to allow for directional cloning of any desired insert. A secretory tag is present to allow for secretion of said insert, and a transdermal tag is present to allow the desired protein product to be secreted. false Rachelle Varga annotation2515393 1 BBa_K1074000 range2515393 1 277 309 annotation2515395 1 BamHI site range2515395 1 313 318 annotation2515397 1 3 range2515397 1 337 461 annotation2515388 1 BBa_K143012 range2515388 1 68 164 annotation2515386 1 5 range2515386 1 1 67 annotation2515391 1 Sec tag range2515391 1 190 276 annotation2515396 1 XmaI site range2515396 1 325 330 annotation2515390 1 BBa_K780001 range2515390 1 165 180 BBa_K2008008_sequence 1 tgcagcccgtgctaacatgaaatgcattgtcatcatcccgaacggaaaaattgcatttggaaaactcaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtatattaagaggaggagatatatataatgaatatcaagaagttcgcaaaacaggcgacagtcctgacctttaccaccgccctcttggcagggggggcgacccaggcattcgctgcttgttcttcttccccatctaagcattgtggtataggatcctaataacccgggtaataatgcagaaccaggttcttgcgcgtctatcgcaggagtgctgaaacaggtgaaatccggagaaattccgaaaggcagcaaggtcgtagctgtgttaacaggaaacggactgaaagatccgaacacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z