BBa_K201012 1 BBa_K201012 Trans-Repressor (7) sequence, to be used for T-REX device 2009-10-11T11:00:00Z 2015-05-08T01:11:22Z Sequence has been synthesized by Sigma-Aldrich as single strand oligos, and annealed in our lab This sequence should have been used for T-REX device but unfortunately we haven't been able to put it on a standard vector within the established deadline. false false _325_ 0 1691 9 It's complicated false This sequence was designed by computer analysis false francesca ceroni BBa_K201012_sequence 1 gaattcgcggccgcttctagagcctctttgtaatattttaatgtatatgtaatgtgttgttaaagtgatagtttgtgtttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z