BBa_K2012000 1 BBa_K2012000 c-di-GMP tandem riboswitche bc3-5 2016-08-04T11:00:00Z 2016-10-09T01:16:18Z From Bacillus thuringiensis subsp. chinensis CT-43 In the CT-43 genome19,20 (GenBank accession: NC_017208.1), five type I c-di-GMP riboswitches named Bc1, Bc2, Bc3, Bc4 and Bc5 RNA (Supplementary Tables S1???S5) were annotated in the Rfam database (http://rfam.sanger.ac.uk/search). Zhou, H., et al. (2016). "Characterization of a natural triple-tandem c-di-GMP riboswitch and application of the riboswitch-based dual-fluorescence reporter." Sci Rep 6: 20871. Three complete c-di-GMP riboswitches (Bc3, Bc4 and Bc5 RNA) with similar structures, which are arranged in tandem to constitute a triple-tandem (Bc3-5 RNA) riboswitch in the 5′-UTR of the cspABCDE mRNA in Bacillus thuringiensis subsp. chinensis CT-43. false false _2479_ 25212 25212 9 false We designed the sequence of bc3-5 by add perfix and suffix which are belong to BioBrick RFC 10. false Pan Chu BBa_K2012011 1 BBa_K2012011 J23117-Bc345 2016-09-14T11:00:00Z 2016-09-15T12:16:33Z J23117 form iGEM parts kit Bc345: see BBa_K2012001 Tandem rioswitches bc345 are located in the promoter J23117 upstream. It can control gene expression. There are low leakage expression of gene which you interest in E.coli whose concentration of c-di-GMP is in a normal level. When cell is induced expression gene which can catalyze c-di-GMP from GTP, the tandem riboswitches would trans to open form and express its downstream gene. false false _2479_ 25212 25212 9 false The bc3 riboswitch is apart of the tandem riboswitch bc3-5. We analysed the sequence of bc3-5 and its scendary structure, found linkers between three complete riboswitches. Using PCR amplify the bc3 sequence which is similar with bc4 and bc5 with prefix and suffix, whereas the secondary structure of bc3 is different from other riboswitches'. false Pan Chu component2483440 1 BBa_J23117 component2483441 1 BBa_K2012000 annotation2483440 1 BBa_J23117 range2483440 1 1 35 annotation2483441 1 BBa_K2012000 range2483441 1 44 528 BBa_J23117 1 BBa_J23117 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23117_sequence 1 ttgacagctagctcagtcctagggattgtgctagc BBa_K2012011_sequence 1 ttgacagctagctcagtcctagggattgtgctagctactagagccacgataaataaatacctatttttggcacactattcgaaaggataggtcgcaaagctaagagtctaaagtaatgaaaattactatgatagtctggttgcagtttggattttcacacatagttgtatgtatgaaaatcgaagaggcaaccggattttttattgtctcaaaaagaaaaaataaatgggcacactattcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccagattttttattgtctcaaaaagaaaaaataaatgggcacactgttcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccaggctttttattttg BBa_K2012000_sequence 1 ccacgataaataaatacctatttttggcacactattcgaaaggataggtcgcaaagctaagagtctaaagtaatgaaaattactatgatagtctggttgcagtttggattttcacacatagttgtatgtatgaaaatcgaagaggcaaccggattttttattgtctcaaaaagaaaaaataaatgggcacactattcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccagattttttattgtctcaaaaagaaaaaataaatgggcacactgttcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccaggctttttattttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z