BBa_K202000 1 M5 TTL Hybrid promoter having multiple operator sites. 2009-10-15T11:00:00Z 2015-05-08T01:11:22Z Synthetic construct having tet O2, lac O1 operator sites. Hybrid promoter having multiple operator sites was designed according to the Lutz R and Bujard H.(Nucleic Acids Res. 1997 Mar 15;25(6):1203-10). The operator sequences are from three unrelated natural regulatory elements: the tetracycline (tet), lactose (lac) and λ-phage operons arranged logically within a single transcriptional unit. The regulatory architecture is designed such that each operator's position efficiently interferes with RNA polymerase (RNAp) promoter binding without inhibiting promoter function. This promoter has tetO2 sites which are having transverse mutation at position 3. The hybrid promoter is cloned upstream to the GFP (part Bba_E0240) in plasmid pSBA1. It is ready for assay. false false _299_ 0 5266 9 It's complicated false two tetO2 sites and one lacO1 site was introduced in and around the Lambda phage. false Poonam Srivastava BBa_K202000_sequence 1 ctaatagtactcacggcgcaataccagcacagcctagtctcgccagaatgctggtcagcatacgaaagagcttaaggcaggccaattcgcactgtcagggtcacttgggtgtttagcatcccaatcagtgattgagattgacatcccaatcagtgattgagatactattgtgagcggataacaattaggaaaccggttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z