BBa_K202001 1 M5 TTN Hybrid promoter having multiple operator sites. 2009-10-15T11:00:00Z 2015-05-08T01:11:22Z Part was designed from tetO2, lambda phage and intervening sequences of the fungus. was designed according to the Lutz R and Bujard H.(Nucleic Acids Res. 1997 Mar 15;25(6):1203-10). The arrangement of the operator sites are the same as in BBa_K202000 except that tetO2 and LacO1 opeartor sequences are replaced by two nonbinding sequences (obtained from noncoding sequences of Fungus). This promoter has tetO2 sites which are having transverse mutation at position 3. The hybrid promoter is cloned upstream to the GFP (part Bba_E0240) in plasmid pSBA1. The construct is ready for promoter assay. false false _299_ 0 5266 9 It's complicated false The regulatory architecture is designed such that each operator's position efficiently interferes with RNA polymerase (RNAp) promoter binding without inhibiting promoter function. false Poonam Srivastava BBa_K202001_sequence 1 ctaatagtactcacggcgcaataccagcacagcctagtctcgccagaatgctggtcagcatacgaaagagcttaaggcaggccaattcgcactgtcagggtcacttgggtgtttagcatcccaatcagtgattgagattgacatcccaatcagtgattgagatactaatggaaggcatcgattagcaggaaaccggttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z