BBa_K203000 1 BBa_K203000 Plasma membrane targeting (GPI anchor) 2009-10-14T11:00:00Z 2015-05-08T01:11:22Z Plasmid DNA. This part encodes the attachement of a GPI anchor, which allows targetting of proteins to which it is tagged to the Plasma Membrane. false false _301_ 0 5074 9 It's complicated false None. false Douaa Mugahid and Michael Bartoschek BBa_K203000_sequence 1 ctagctaaggttctgtctggttttctgtcacatttcagaatacctaaaaatgaagaaattgtcttctcaattaaagaacattcatatacagcacaatacatgttgtaattactgctaatggtatgggtataagtgcatatctgtgtctagaatgaccgctgcttgggacta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z