BBa_K2036002 1 BBa_K2036002 Prd29A 2016-09-18T11:00:00Z 2016-10-24T11:39:50Z come from the upstream of Arabidopsis thaliana gene rd29A Arabidopsis thaliana promoter contains 2 DRE(dehydration-responsive element) 1 ABRE(ABA resiponsive element) false false _2503_ 33577 25901 9 false It can serve as a promoter when express plant Arabidopsis thaliana gene, and the transcription can be regulated by ABA-response related factors derived from Aradidopsis thaliana. false Wangjie Liu BBa_K2036002_sequence 1 gatatactaccgacatgagttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacgaaaacagacgcttcatacgtgtccctttatctctctcagtctctctataaacttagtgagaccctcctctgttttactcacaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z