BBa_K2039004 1 BBa_K2039004 Coding sequences of proteins FRB* and GFP11 (subunit of tripartite GFP) 2016-10-13T11:00:00Z 2016-10-14T08:39:06Z Synthetic. This part is the complementary part of Bba_K2039003. The FRB/FKBP12 system is an inducible system. Originally found in mammals, these two proteins form an heterodimer when rapamycin is added in the medium. It is particularly useful for protein interaction studies. The FRB sequence has been modified in order to dimerize with a non toxic rapamycin analog (rapalog). The mutations introduced are : T2098L, K2095P, W2101F. It has also been codon optimized with Jcat plateforme to be expressed in bacteria. FKBP protein is linked to GFP 10. The tripartite split-GFP is composed of two times of 20 amino-acids long GFP tags (GFP 10 and GFP 11) and a third complementary subsection (GFP 1-9). false false _2506_ 31202 31202 9 false No specific considerations false Maxence Pfeiffer BBa_K2039004_sequence 1 tactagatgatcctgtggcacgaaatgtggcacgaaggtctggaagaagcttctcgtctgtacttcggtgaacgtaacgttaaaggtatgttcgaagttctggaaccgctgcacgctatgatggaacgtggtccgcagaccctgaaagaaacctctttcaaccaggcttacggtcgtgacctgatggaagctcaggaatggtgccgtaaatacatgaaatctggtaacgttccggacctgctgcaagctttcgacctgtactaccacgttttccgtcgtatctctaaagagctcggatccgatgtaggaggtggaggtagtgaaggaggaggtagcggtggtccgggaagcgcaggcgaaggcagcgcggtaggaggttctgctggaggtggcagcgaaaaacgcgatcatatggtgctgctggaatatgtgaccgcggcgggcattaccgatgcgagctaataacgctgatagtgctagtgtagatcgctactagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z