BBa_C0170 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0070 except no LVA tag false true _11_1_ 0 61 7 In stock false true jcbraff annotation1891586 1 rhII range1891586 1 1 609 BBa_K204040 1 BBa_K204040 C₄HSL generater 2009-10-11T11:00:00Z 2015-05-08T01:11:23Z p(tetR)+RBS+RhlI+terminater C4HSL generater<br> p(tetR)+RBS+RhlI+terminater false false _304_ 0 5360 9 It's complicated false p(tetR)+RBS+RhlI+terminater false Uno Keisuke component2034509 1 BBa_R0040 component2034515 1 BBa_B0034 component2034520 1 BBa_B0012 component2034517 1 BBa_C0170 component2034518 1 BBa_B0010 annotation2034520 1 BBa_B0012 range2034520 1 786 826 annotation2034517 1 BBa_C0170 range2034517 1 81 689 annotation2034515 1 BBa_B0034 range2034515 1 63 74 annotation2034509 1 BBa_R0040 range2034509 1 1 54 annotation2034518 1 BBa_B0010 range2034518 1 698 777 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K204040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0170_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z