BBa_K2047009 1 BBa_K2047009 Stem loop with free energy of -25.6 kcal/mol measured by Mfold 2016-10-18T11:00:00Z 2016-10-21T12:58:19Z no This sequence is used for measuring the regulation effect of stem loop of free energy -25.6 kcal/mol false false _2514_ 30452 30452 9 false none false Yifei Li BBa_K2047009_sequence 1 gtcgacgatcgcctgatcccggtgcacccgggatcaggccgcggctagcgtgaaaatacgagaatattatttgtattgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z