BBa_K2050424 1 BBa_K2050424 Adenoviral VA1 RNA gene 2016-10-13T11:00:00Z 2016-10-14T12:01:33Z The sequence is bases 10597 to 10790 of the Ad5 genome (GenBank accession number X02996). The VA1 RNA gene is an RNA polymerase III-driven gene that encodes the viral RNA VA1. By its nature, the RNA molecule facilitates infection by inhibiting the protein kinase R response, which is activated in infected cells and acts to globally suppress gene expression to inhibit viral replication. Co-expressing the VA1 RNA gene with a desired non-coding RNA gene allows for the expression of the desired RNA molecule, which would generally trigger PKR response, without sacrificing RNA polymerase II transcription. false false _2518_ 30522 30522 9 false None false Muhammad Farhan Maruli BBa_K2050424_sequence 1 gtgcaaaaggagagcctgtaagcgggcactcttccgtggtctggtggataaattcgcaagggtatcatggcggacgaccggggttcgagccccgtatccggccgtccgccgtgatccatgcggttaccgcccgcgtgtcgaacccaggtgtgcgacgtcagacaacgggggagtgctccttttggcttccttcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z