BBa_K2056002 1 BBa_K2056002 pNirK - promoter region 'nirK' (nitrite reductase) 2016-10-12T11:00:00Z 2016-10-13T10:23:32Z This part has been designed after the part BBa_K248002 in the Registry of Standard Biological Parts. This part is the promoter region of the nirK gene of Nitrosomonas europaea. The transcriptional regulatory factor NsrR (BBa_K2056001) controls transcription. false false _2524_ 33019 33019 9 false Because the part Bba_K1682011 was not available from the registry, we had to get it synthesized. We had to codon optimize this part to conform to assembly standards and the requirements for synthesis. false Muhammad Ismail BBa_K2056002_sequence 1 gttgcgcgtaatacggtcacgattcgtaatttccgtaacggaggacagtttctttcatttcagactgagatttccgaggatgcttaacgcgtgattgccgtgattcgccagtcccatgaagtccttccaatttattgagtgggcgttaataagtatattcctacattcttatttcttccagattggttaacgatctaaattgaacgcgtcaaaagcatcaaacgttatattaacaacattagtctgcgtggcggtgggtaatgatcgcctaagaagctgaacatgaccgtctttaagggcttatcctgtaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z