BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066528 1 BBa_K2066528 ACTAGA Scar 2016-10-11T11:00:00Z 2016-10-12T12:34:02Z ACTAGA, scar present in Lou et al. 2012 ???Ribozyme-based insulator parts buffer synthetic circuits from genetic context??? RiboJ sequence, Supplement Section V. This is the scar as the end of the RiboJ sequence (Lou et al. 2012) which we conserved through all of our uses of RiboJ <partinfo>BBa_K2066506<\partinfo>. This exists as a parts page so that it can be inserted into sequences which do not have RiboJ but still have the scar for the sake of continuity. false false _2534_ 27446 27446 9 false N/A false Joseph L Maniaci BBa_K2066508 1 BBa_K2066508 Modified pLacO-1 Promoter (Lou et. al 2012) 2016-08-30T11:00:00Z 2016-08-31T09:01:04Z Part sequence inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) This promoter sequence is modified from section V of Supplementary Material of Lou et al. The Supplementary sequence contains 98bp of the end of BioBrick backbone pSB1C3, followed by an EcoRI site and an XbaI site, then 20bp of the beginning of pTac (as described in fig. S1), before beginning the sequence of plLacO-1 (as described in fig. S1). Here we use only the 20bp of pTac followed by the plLacO-1 sequence as described in fig. S1. WM iGEM 2016 used this part for our Ribozyme Characterization project. false false _2534_ 31541 31541 9 false Design inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) so that constitutive LacI repressor can bind to it. false Likhitha Kolla BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066510 1 BBa_K2066510 Strong RBS from Lou et. al 2012 2016-08-30T11:00:00Z 2016-08-31T09:32:28Z Sequence is from from Lou et al. Supplement section V. This part is a strong RBS from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The RBS is used to make some of 2016 WM iGEM Ribozyme Characterization project parts. false false _2534_ 31541 31541 9 false RBS sequence from Lou et. al 2012 false Likhitha Kolla BBa_K2066509 1 BBa_K2066509 sfGFP 2016-08-30T11:00:00Z 2016-10-19T02:54:25Z The sequence for this sfGFP reporter gene is modified from Lou et al. Supplement section V. This is the sequence of superfolder GFP BBa_I746916, but with four codon modifications to match WM16_015: at position 441, G->T. At 446, C->T. At 495, T->C. At 562, C->A. The part is a reporter used for K2066014. false false _2534_ 31541 31541 9 false Design inspired by Lou et. al. 2012 false Likhitha Kolla BBa_K2066026 1 BBa_K2066026 plLac0-1 sfGFP 2016-08-31T11:00:00Z 2016-10-12T12:37:31Z The promoter, RBS, and reporter sequences from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". UNS sequences from Torella et. al 2013 "Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly" This part is used for 2016 WM iGEM Ribozyme Characterization project. Lou et. al showed that sequences in the 5' UTR of a gene can affect the input-output relationship (transfer function) of a circuit. The RiboJ serves as an insulator to generalize the transfer function of a circuit regardless of promoter. The part is used in combination with BBa_K2066016 (constitutive Lac Repressor) to look at input-output relationship of IPTG-sfGFP without RiboJ. false false _2534_ 27446 31541 9 false Part designed to be compared with K2066014 (with RiboJ) to see the effect of RiboJ on the transfer function. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2494685 1 BBa_K2066508 component2494686 1 BBa_K2066528 component2494696 1 BBa_K2066019 component2494688 1 BBa_K2066509 component2494684 1 BBa_K2066018 component2494687 1 BBa_K2066510 component2494695 1 BBa_B0015 annotation2494688 1 BBa_K2066509 range2494688 1 137 856 annotation2494685 1 BBa_K2066508 range2494685 1 41 118 annotation2494684 1 BBa_K2066018 range2494684 1 1 40 annotation2494696 1 BBa_K2066019 range2494696 1 986 1025 annotation2494686 1 BBa_K2066528 range2494686 1 119 124 annotation2494695 1 BBa_B0015 range2494695 1 857 985 annotation2494687 1 BBa_K2066510 range2494687 1 125 136 BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066509_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066026_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacactagaaggaggaaaaaaatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066510_sequence 1 aggaggaaaaaa BBa_K2066508_sequence 1 ggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcac BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2066528_sequence 1 actaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z