BBa_K2066508 1 BBa_K2066508 Modified pLacO-1 Promoter (Lou et. al 2012) 2016-08-30T11:00:00Z 2016-08-31T09:01:04Z Part sequence inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) This promoter sequence is modified from section V of Supplementary Material of Lou et al. The Supplementary sequence contains 98bp of the end of BioBrick backbone pSB1C3, followed by an EcoRI site and an XbaI site, then 20bp of the beginning of pTac (as described in fig. S1), before beginning the sequence of plLacO-1 (as described in fig. S1). Here we use only the 20bp of pTac followed by the plLacO-1 sequence as described in fig. S1. WM iGEM 2016 used this part for our Ribozyme Characterization project. false false _2534_ 31541 31541 9 false Design inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) so that constitutive LacI repressor can bind to it. false Likhitha Kolla BBa_K2066510 1 BBa_K2066510 Strong RBS from Lou et. al 2012 2016-08-30T11:00:00Z 2016-08-31T09:32:28Z Sequence is from from Lou et al. Supplement section V. This part is a strong RBS from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The RBS is used to make some of 2016 WM iGEM Ribozyme Characterization project parts. false false _2534_ 31541 31541 9 false RBS sequence from Lou et. al 2012 false Likhitha Kolla BBa_K2066509 1 BBa_K2066509 sfGFP 2016-08-30T11:00:00Z 2016-10-19T02:54:25Z The sequence for this sfGFP reporter gene is modified from Lou et al. Supplement section V. This is the sequence of superfolder GFP BBa_I746916, but with four codon modifications to match WM16_015: at position 441, G->T. At 446, C->T. At 495, T->C. At 562, C->A. The part is a reporter used for K2066014. false false _2534_ 31541 31541 9 false Design inspired by Lou et. al. 2012 false Likhitha Kolla BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066506 1 BBa_K2066506 RiboJ (Ribozyme Insulator) Lou et. al. 2012 2016-08-30T11:00:00Z 2016-10-12T12:27:33Z Part sequence is from Lou et al. 2012, Supplemental Section V (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). RiboJ is the sequence for a ribozyme studied in Lou et. al 2012 ("Ribozyme-based insulator parts buffer synthetic circuits from genetic context"). WM iGEM 2016 used this sequence between the promoter and ribosome sequence. One of our goals for using this part is moving it onto a Biobrick backbone. Furthermore, In Lou et. al, this ribozyme sequence was said to act as an insulator which generalizes protein expression levels for a given promoter. We used RiboJ to collect data for our Ribozyme characterization project as well as our ribosome and promoter characterization projects. false false _2534_ 27446 31541 9 false We designed this part to use as an insulator and also move this riboJ sequence onto a Biobrick backbone. false Likhitha Kolla BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K2066110 1 BBa_K2066110 pLacO1 sfGFP + LacI 2016-10-13T11:00:00Z 2016-10-28T09:01:44Z To be completed To be completed false false _2534_ 31544 31547 9 false To be completed false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, &#65532;Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2530747 1 BBa_K2066018 component2530751 1 BBa_K2066509 component2530748 1 BBa_K2066508 component2530770 1 BBa_B0015 component2530758 1 BBa_B0015 component2530759 1 BBa_K2066507 component2530762 1 BBa_B0034 component2530763 1 BBa_K2066524 component2530749 1 BBa_K2066506 component2530750 1 BBa_K2066510 component2530760 1 BBa_J23101 component2530771 1 BBa_K2066019 annotation2530763 1 BBa_K2066524 range2530763 1 1128 2219 annotation2530751 1 BBa_K2066509 range2530751 1 212 931 annotation2530758 1 BBa_B0015 range2530758 1 932 1060 annotation2530747 1 BBa_K2066018 range2530747 1 1 40 annotation2530748 1 BBa_K2066508 range2530748 1 41 118 annotation2530762 1 BBa_B0034 range2530762 1 1116 1127 annotation2530750 1 BBa_K2066510 range2530750 1 200 211 annotation2530770 1 BBa_B0015 range2530770 1 2220 2348 annotation2530749 1 BBa_K2066506 range2530749 1 119 199 annotation2530771 1 BBa_K2066019 range2530771 1 2349 2388 annotation2530760 1 BBa_J23101 range2530760 1 1081 1115 annotation2530759 1 BBa_K2066507 range2530759 1 1061 1080 BBa_K2066507 1 BBa_K2066507 UNS 6.1 (Torella et. al 2013) 2016-08-30T11:00:00Z 2016-10-19T06:10:34Z UNS 6.1 sequence derived from (Torella et. al 2013) "Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly". This part is used as a spacer. WM iGEM 2016 used this part as a spacer to connect two separate composite parts onto the same plasmid. For example, UNS 6.1 was used as a spacer to connect K2066022(TetR on UNS) and K2066023(pTET GFP on UNS) to make K2066053. false false _2534_ 31544 31541 9 false Used this part as a spacer. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K2066524 1 BBa_K2066524 LacI no LVA 2016-10-11T11:00:00Z 2016-10-12T10:09:36Z Derived from BBa_C0012. This is a modified LacI repressor (C0012) with the LVA tail removed. This basic part contains no RBS. false false _2534_ 31526 31526 9 false Translated the C0012 sequence and selected everything before the coding sequence for LVA, which is AANDENYALVA. I then added the stop codon tga to the end of the truncated C0012 sequence false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K2066509_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0034_sequence 1 aaagaggagaaa BBa_K2066524_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga BBa_K2066508_sequence 1 ggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcac BBa_K2066110_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactagaaggaggaaaaaaatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatactcgttcgctgccacctaagtttacagctagctcagtcctaggtattatgctagcaaagaggagaaaatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066507_sequence 1 ctcgttcgctgccacctaag BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066510_sequence 1 aggaggaaaaaa BBa_K2066506_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactaga BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z