BBa_K2066506 1 BBa_K2066506 RiboJ (Ribozyme Insulator) Lou et. al. 2012 2016-08-30T11:00:00Z 2016-10-12T12:27:33Z Part sequence is from Lou et al. 2012, Supplemental Section V (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). RiboJ is the sequence for a ribozyme studied in Lou et. al 2012 ("Ribozyme-based insulator parts buffer synthetic circuits from genetic context"). WM iGEM 2016 used this sequence between the promoter and ribosome sequence. One of our goals for using this part is moving it onto a Biobrick backbone. Furthermore, In Lou et. al, this ribozyme sequence was said to act as an insulator which generalizes protein expression levels for a given promoter. We used RiboJ to collect data for our Ribozyme characterization project as well as our ribosome and promoter characterization projects. false false _2534_ 27446 31541 9 false We designed this part to use as an insulator and also move this riboJ sequence onto a Biobrick backbone. false Likhitha Kolla BBa_K2066506_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z