BBa_K2066508 1 BBa_K2066508 Modified pLacO-1 Promoter (Lou et. al 2012) 2016-08-30T11:00:00Z 2016-08-31T09:01:04Z Part sequence inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) This promoter sequence is modified from section V of Supplementary Material of Lou et al. The Supplementary sequence contains 98bp of the end of BioBrick backbone pSB1C3, followed by an EcoRI site and an XbaI site, then 20bp of the beginning of pTac (as described in fig. S1), before beginning the sequence of plLacO-1 (as described in fig. S1). Here we use only the 20bp of pTac followed by the plLacO-1 sequence as described in fig. S1. WM iGEM 2016 used this part for our Ribozyme Characterization project. false false _2534_ 31541 31541 9 false Design inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) so that constitutive LacI repressor can bind to it. false Likhitha Kolla BBa_K2066508_sequence 1 ggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z