BBa_K2066521 1 BBa_K2066521 UNS 6.2 2016-10-08T11:00:00Z 2016-10-19T06:13:17Z Torella et al. 2013 (???Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly???) The second half of UNS 6. The sequence is taken from Torella et al. 2013 (???Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly???). This is used in K2066040 and K2066041. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066521_sequence 1 aatactctacggtcacatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z