BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K2070016 1 BBa_K2070016 Constitutive ecf16 generator 2016-10-08T11:00:00Z 2016-10-20T05:20:31Z To be edited To be edited false false _2538_ 31975 31975 9 false To be edited false iGEM UT-Tokyo 2016 component2510072 1 BBa_J23101 component2510083 1 BBa_B0015 component2510074 1 BBa_B0032 component2510076 1 BBa_K2070001 annotation2510074 1 BBa_B0032 range2510074 1 44 56 annotation2510072 1 BBa_J23101 range2510072 1 1 35 annotation2510076 1 BBa_K2070001 range2510076 1 63 650 annotation2510083 1 BBa_B0015 range2510083 1 659 787 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K2070001 1 ecf16 ecf16 2016-10-08T11:00:00Z 2016-10-20T05:45:54Z Pseudomonas entomophila L48 ecf16 is a sigma factor, one of transcription factors, which activates ecf16 promoter (BBa_K2070000). false false _2538_ 31975 31975 9 false For detail, see our wiki false iGEM UT-Tokyo 2016 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2070001_sequence 1 atgcagcgcaccaacagccaggatgtgctgagcacccgcgaaagccagcttcaggcgctgctgcttcagggcctggcgggcgatacctttgcgtatcgccagtttctgaccgcgctggcggcgcatattcgcggctttctgcgccgccgcctgccgcagcatccggcggaagtggaagatctgcttcaggaagtgctgctggcggtgcataacgcgcgccatacctatcaggcgcgccagccgctgaccgcgtgggtgcaggcgattgcgcgctataaactggcggatcatctgcgcagccatgcgcgccgcgaagcgcgccatgatctgctggatgatgatagcgaactgtttgcggcgagcgatgaacagccggcgcaggcgagccgcgatctgggcaaactgctgggccagctgccggatcgccagcgcctgccgattgtgcatgtgaaactggaaggcctgagcgtggaagaaaccgcgcagattaccggcctgagcagcagcgcggtgaaagtgggcattcatcgcggcctgaaagcgctgggcaaactgattcgcggcaaaggccatgatgaagatcgctaa BBa_K2070016_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaagtactagatgcagcgcaccaacagccaggatgtgctgagcacccgcgaaagccagcttcaggcgctgctgcttcagggcctggcgggcgatacctttgcgtatcgccagtttctgaccgcgctggcggcgcatattcgcggctttctgcgccgccgcctgccgcagcatccggcggaagtggaagatctgcttcaggaagtgctgctggcggtgcataacgcgcgccatacctatcaggcgcgccagccgctgaccgcgtgggtgcaggcgattgcgcgctataaactggcggatcatctgcgcagccatgcgcgccgcgaagcgcgccatgatctgctggatgatgatagcgaactgtttgcggcgagcgatgaacagccggcgcaggcgagccgcgatctgggcaaactgctgggccagctgccggatcgccagcgcctgccgattgtgcatgtgaaactggaaggcctgagcgtggaagaaaccgcgcagattaccggcctgagcagcagcgcggtgaaagtgggcattcatcgcggcctgaaagcgctgggcaaactgattcgcggcaaaggccatgatgaagatcgctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0032_sequence 1 tcacacaggaaag BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z