BBa_K2071953 1 BBa_K2071953 A non-specific phosphotransferase, codon optimized for B.subtilis. Characterized in https://microbia 2016-10-13T11:00:00Z 2016-10-28T05:53:10Z This part comes from the genome of Thermotoga maritima , and is normally used in T.maritima as a beta-phosphoglucomutase, however later study showed the protein to be highly effective at dephosphorylating Erythrose-4-Phosphate. https://microbialcellfactories.biomedcentral.com/articles/10.1186/s12934-016-0458-y This part codes for a phosphotransferase that is able to de-phosphorylate Erythrose-4-Phosphate. It is not a highly specific phosphotransferase and while it operates on both Erythrose-4-Phosphate, its original designation as a beta-phosphoglucomutase indicates it is relatively non-specific. This may pose an issue for cellular growth. It is recommended to grow the bacteria at a lower temperature to determine if non-specific de-phosphorylation is an issue. false false _2539_ 30728 30728 9 false We had two major design considerations when working with this sequence. Firstly we had to ensure that the sequence was codon optimized for eventual expression in Bacillus subtilis. We then also had to ensure that no RFC10 restriction sites were in the submitted sequence. We were able to correct both of these issues simultaneously using IDT???s codon optimization software. false Pavle Jeremic BBa_K2071953_sequence 1 atggaagcggtaatttttgatatggacggggttctgatggataccgagcctttatactttgaagcctatcggagagtggcagaaagctatggcaagccatatacggaagatctgcatcggcgcataatgggagttccggaaagagaggggctgccaatcctgatggaggccttagagatcaaggatagtcttgagaattttaaaaaacgtgtccatgaagagaaaaagcgcgttttctcagaactgcttaaagaaaatcctggggtacgggaagcccttgagttcgttaagagcaaacggataaaactggcattagctacctccactcctcaacgggaggctcttgagcggttacggcgtctcgatttagaaaaatactttgatgtaatggtatttggggatcaagttaagaatgggaagccagacccagaaatctatctgttggtcctcgaacgccttaacgtagtgcctgagaaggtagtggttttcgaggacagcaagtccggtgttgaggccgctaaaagtgcaggaatagagcggatatatggggtagtacactccctgaatgatggtaaagcacttctggaggccggcgctgttgctcttgttaaaccagaagagattttgaacgtcttgaaggaagttctttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z