BBa_K2075003 1 TEV Site TEV cleavage site 2016-10-12T11:00:00Z 2016-10-18T02:03:53Z gagaatttgtacttccagtca The TEV site is a DNA Sequenz encoding an aminoacid sequenz, which is cut by the TEV protease. The TEV protease is an protease with a high sequence specifity. The origin of the TEV protease is the tobacco each virus. We use the TEV Site to get our circularised TALE protein back into a linear form. Only the linear TAL effector protein can bind the target sequenz. false false _2543_ 33470 33470 9 false No considerations false Kim Luehmann annotation2499185 1 TEV Site range2499185 1 1 21 BBa_K2075003_sequence 1 gagaatttgtacttccagtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z