BBa_K2080003 1 BBa_K2080003 bax-sgRNA3 2016-09-21T11:00:00Z 2016-09-22T11:22:54Z From BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription false Haojian Li annotation2523854 1 misc range2523854 1 285 366 annotation2523831 1 U6 promoter range2523831 1 1 265 annotation2523851 1 gRNA range2523851 1 266 284 BBa_K2080003_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggcagcggccattttgcggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z