BBa_K208111 1 BBa_K208111 Weak promoter for Rhodobacter sphaerodies 2009-10-14T11:00:00Z 2015-05-08T01:11:25Z from Rhodobacter sphaerodies. This BioBrick part is designed for gene expression in Rhodobacter sphaerodies. false true _310_ 0 5669 9 Not in stock false Not work in E coli. false Junling Huo BBa_K208111_sequence 1 aaattgttacggagcccaaaaaatccgcttgcgcccggggccgtctgctcctagaaaccgcttcaccgagacgaagaccggcagcgccggacggagacgagggagcggatgacagaaacgtcggccgcgacaattgaagatgaggcggacgggatcgctggttgtctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z