BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966896 1 SD range1966896 1 90 95 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 BBa_K592011 1 cjBlue cjBlue, green chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z Cnidopus japonicus This chromoprotein, cjBlue, naturally exhibits strong green/blue color when expressed. Compared to amilCP(BBa_K592009) and amilGFP(BBa_K592010), the color development is slower. On agar plates and in liquid culture, the color is readily visible to naked eye after 24-48 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 In stock false Codon-optimization for expression in E.coli necessary. false Antonio Ascue Avalos annotation2131787 1 cjBlue range2131787 1 1 699 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K823017 1 BBa_K823017 double terminator (B0012-B0011) 2012-09-10T11:00:00Z 2015-05-08T01:13:30Z Part:BBa_B0014 Released HQ 2013 This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false false _1081_ 0 11555 9 In stock false This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false Jara Radeck component2182657 1 BBa_B0014 annotation2182657 1 BBa_B0014 range2182657 1 1 95 BBa_K2113006 1 BBa_K2113006 temperature sensitive system with RNA thermometer with cj blue 2016-10-13T11:00:00Z 2016-10-14T01:48:16Z nil The RNA thermometer (BBa_K115001) is expressed under the regulation of the part (BBa_J23119) which contains a strong promoter. Following the RNA thermometer the construct contains cjblue(BBa_K592011) as the reporter which is followed by the double terminator (BBa_K823017). false false _2581_ 25972 25972 9 false nil false SVCE_CHENNAI component2501125 1 BBa_J23119 component2501142 1 BBa_K823017 component2501134 1 BBa_K592011 component2501132 1 BBa_K115001 annotation2501142 1 BBa_K823017 range2501142 1 856 950 annotation2501134 1 BBa_K592011 range2501134 1 146 847 annotation2501132 1 BBa_K115001 range2501132 1 44 139 annotation2501125 1 BBa_J23119 range2501125 1 1 35 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_K2113006_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_K823017_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K592011_sequence 1 atggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z