BBa_K215251 1 BBa_K215251 Lpp + 5tmr OmpA + GS Linker + TEV site + NheI Site 2009-09-29T11:00:00Z 2015-05-08T01:11:30Z Harvard iGEM 2006: BBa_J36848. We added a GS Linker and TEV site. This is a fusion protein that displays your favorite gene inserted into the NheI site. See BBa_K215250 for 1tmr OmpA. false false _320_ 0 5567 9 Not in stock false Anything inserted into the NheI shouldn't have a start codon and gene should still be in frame. false Alex Leone annotation2027619 1 GS Linker - GGGSGGGSGGG range2027619 1 436 468 annotation2027620 1 TEV Site - ENLYFQG range2027620 1 469 489 annotation2027618 1 BBa_J36837 - 5tmr OmpA range2027618 1 94 435 annotation2027617 1 BBa_J36835 - Lpp Signaling Peptide range2027617 1 1 87 annotation2027643 1 NheI range2027643 1 490 495 BBa_K215251_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagactagaaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggtggtggttctggtggtggttctggtggtggtgaaaacctgtattttcagggtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z