BBa_K223000 1 BBa_K223000 SoxR binds with NO to activate SoxS (NO promoter) 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z paper SoxR binds with NO to activate SoxS (NO promoter) true false _380_ 0 4533 9 Discontinued false sequence false Suzanne Bartram BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K223002 1 BBa_K223002 RBS + SoxR- ribosome binding site and SoxR gene 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z RBS + SoxR- ribosome binding site and SoxR geneRBS + SoxR- ribosome binding site and SoxR gene RBS + SoxR- ribosome binding site and SoxR gene true false _380_ 0 4533 9 Discontinued false RBS + SoxR- ribosome binding site and SoxR gene false Suzanne Bartram component2009090 1 BBa_B0034 component2009091 1 BBa_K223000 annotation2009091 1 BBa_K223000 range2009091 1 19 483 annotation2009090 1 BBa_B0034 range2009090 1 1 12 BBa_B0034_sequence 1 aaagaggagaaa BBa_K223000_sequence 1 atggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaa BBa_K223002_sequence 1 aaagaggagaaatactagatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z