BBa_K223051 1 BBa_K223051 5MT operon (promoter-operator) 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Originally taken from "Naturally occurring promoter down mutation: Nucleotide sequence of the trp promoter/operator/leader region of Shigella dysenteriae 16" (Miozzari,G and Yanfosky, C. Proc. Natl. Acad. Sct. USA. Vol. 75, No. 11, pp. 5580-5584, November 1978. Genetics). Sequence modifications done by Stanford iGEM 2009. This is a modified trp operon, promoter and operator site, that recognizes and binds to a doubly mutant repressor sequence and its corepressor, 5-methyl-L-tryptophan. In conjunction with the mutant tryptophan repressor, this modified operon functions as an inverter, converting input 5-methyl tryptophan levels and converting decreasing levels of 5MT into a PoPs output signal for downstream transcription. false false _380_ 0 4529 9 Not in stock false Point mutation from A to C on the second aporepressor binding site (i.e. -18) on the sense strand. false Anusuya Ramasubramanian BBa_K223051_sequence 1 gaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z