BBa_K242301 1 BBa_K242301 multi-LER binding site +promoter 2 2009-10-20T11:00:00Z 2015-05-08T01:11:37Z EPEC O127:H6 LEE encoded regulator LER is a transcriptional activator of all the LEE operons in Enteropathogenic and Enterohemorragic Escherichia Coli. This region of LEE 5 from EPEC LEE5 operon has a multi-LER binding site and specific location of the promoter and TSS. It does not have a RBS. false false _340_ 0 4754 9 Not in stock true Sequence depicted by San mart??n et. al, 2001. Transcriptional Regulation of the orf19 Gene and the tir-cesT-eae Operon of Enteropathogenic Escherichia coli. Journal of Bacteriology, vol. 183, No. 9. false Luis Fernando Monta??o Guti??rrez annotation2057858 1 E.coli promoter range2057858 1 208 237 annotation2057862 1 tir transcription start site range2057862 1 244 244 annotation2057842 1 poly LER binding site range2057842 1 40 86 BBa_K242301_sequence 1 tagggggaaacttactgcgctgttatttttttcttgatgcaaaaaggtctctatagacgtttaaaataaaatattatttttcaatacacaattaaatttctgcatataaaaattataattattttttttcgataattatataatgattttgattatgtgattttttagttggaaatacagacatgcatttctggtgcgttattttgcttgcatcaaaaattatactgtgatttatttggtttatgctcagttgttttatcggctgcataccgttacgtcatagtaatataaaggaacgtgtcaaatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z