BBa_K243002 1 DsbA DsbA signal sequence (enables periplasm export) 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z Sequence of the DsbA was copied out from E.coli B genom Synthesized oligos with signal sequence of DsbA by sigma. The signal sequence of DsbA linked to an cds of e.g.a protein, applies the exportation of the protein to the periplasm. The accumulation of the expressed protein in the periplasm, can be used for the purification of the protein. false false _352_ 0 4732 9 It's complicated false the signal sequence had to be located at the N-terminus of the (fusion)protein. false Freiburg Bioware09 annotation2041875 1 Dsba signal sequence range2041875 1 1 54 BBa_K243002_sequence 1 aaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z