BBa_K243001 1 Fok_i Protein domain (inactive) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the inactive domain of our universal restriction endonuclease. It fused with the active protein domain of our universal restriction endonuclease(BBa_K243000)and linked with specific oligos. false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic inactive heterodimer) -heterodimeric amino acids * switch Glutamin 486/298-300 to Glutamate (CAA->GAA) * switch Isoleucin 499/337-339 to Leucin (ATC->CTG) -catalytic amino acids * switch Aspartate 450/190-192 to Alanin (GAC->GCG) * switch Aspartate 467/243-245 to Alanin (GAT->GCG) false Freiburg Bioware09 annotation2041872 1 Fok_i range2041872 1 1 579 BBa_K243005 1 MiddleLink Middle Linker ( Gly-Gly-Ser-Gly)x2 2009-10-13T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. We used this part to connect our protein domains with our lipocalin domains, for our project the universal endonuclease.The sequence produced the aminoacids Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly . false false _352_ 0 4732 9 It's complicated false None. false Freiburg Bioware09 annotation2041884 1 MiddleLinker range2041884 1 1 24 BBa_K157004 1 BBa_K157004 Fluoresceine-A-binding 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by GeneArt, optimized for expression in homo sapiens. Fluoresceine A -binding derivative of a Lipocalin (BBP, bilin binding protein from pieris brassicae), originally designed by Arne Skerra [see Ref. 1,2]. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040659 1 Lipocalin FluA range2040659 1 1 522 BBa_K243025 1 BBa_K243025 Strep-FluA-Middle Linker-Fok_i 2009-10-17T11:00:00Z 2015-05-08T01:11:37Z Combined by serial clonig steps. This combination of parts use the benefits of an Strep-tag and is linked with a FluroescineA tag. The MiddleLinker (GlySerGlyGly)x2 produce a certain distance between the FluA tag and the protein domain Fok_i. false false _352_ 0 4732 9 It's complicated false The linker length and the choice of the purification tag in combination with the anticalin tag allowed us several combination possibilities, which we had to prove to achieve the best combination. false Freiburg Bioware09 component2051368 1 BBa_B0105 component2051376 1 BBa_B0105 component2051370 1 BBa_K157004 component2051374 1 BBa_K243005 component2051378 1 BBa_K243001 component2051366 1 BBa_K157012 component2051372 1 BBa_B0105 annotation2051372 1 BBa_B0105 range2051372 1 553 558 annotation2051374 1 BBa_K243005 range2051374 1 559 582 annotation2051366 1 BBa_K157012 range2051366 1 1 24 annotation2051376 1 BBa_B0105 range2051376 1 583 588 annotation2051370 1 BBa_K157004 range2051370 1 31 552 annotation2051368 1 BBa_B0105 range2051368 1 25 30 annotation2051378 1 BBa_K243001 range2051378 1 589 1167 BBa_K157012 1 BBa_K157012 Strep affinity tag II; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008. Strep tag as NgoMIV / AgeI protein fusion part, fusion to proteins facilitates detection, purification, immobilization. false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2041865 1 Strep-Tag II range2041865 1 1 24 annotation2041866 1 Strep-Tag II range2041866 1 1 24 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K157012_sequence 1 tggagccatccgcagtttgaaaaa BBa_K243005_sequence 1 ggtggttctggtggtggttctggt BBa_K243001_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K243025_sequence 1 tggagccatccgcagtttgaaaaaaccggcgacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaacaccggcggtggttctggtggtggttctggtaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaaccagcaggtgccatttataccgttggttccccgatcgattatggcgttatcgtggccacaaaagcgtattctggcggttataatctgccgattggtcaggctgatgagatggaacgttatgtggaagagaatcagacccgtaacaaacatctgaacccgaacgaatggtggaaagtgtatccgtcaagtgtcaccgagttcaaatttctgttcgtgagcggccactttaaaggcaactataaagcccagctgactcgtctgaaccatatcaccaatagcaatggggcagtgctgagtgttgaggaactgctgatcggtggagaaatgatcaaagcaggcaccctgactctggaagaagttcgccgtaaattcaacaatggcgagatcaatttt BBa_K157004_sequence 1 gacgtgtaccacgacggcgcctgccccgaagtgaagcccgtggacaacttcgactggtcccagtaccacggcaagtggtgggaggtggccaagtaccccagccccaacggcaagtatggcaagtgcggctgggccgagtacacccccgagggcaagagcgtgaaggtgtccagatacgacgtgatccacggcaaagaatacttcatggaaggcaccgcctaccccgtgggcgacagcaagatcggcaagatctaccacagccggaccgtgggcggctacaccagaaagaccgtgttcaacgtgctgtccaccgacaacaagaactacatcatcggctacagctgccgctacgacgaggacaagaagggccactgggaccacgtgtgggtgctgtcccggtccatggtgctgaccggcgaggccaagaccgccgtggagaactacctgatcggcagccccgtggtggacagccagaaactggtgtacagcgacttcagcgaggccgcctgcaaagtgaacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z