BBa_K243027 1 Fos His-FOS 2009-10-18T11:00:00Z 2015-05-08T01:11:37Z Ordered by Mr.gene. The heterodimeric Fos complex is a transcriptional activator involved in the signal transduction pathway. Via leucin zipper they interact among each other and with their bipartite domain, rich of basic amino acids, they bind DNA (Abate et al., Mol Cell Biol. 1991 July). false false _352_ 0 4732 9 It's complicated false none. false Freiburg Bioware09 annotation2061297 1 Fos range2061297 1 1 216 BBa_K243027_sequence 1 catcatcatcatcatcatggatccggagaagaaaaacgtcgtattcgtcgtgaacgtaataaaatggcggcggcgaaaagccgtaatcgtcgtcgtgaactgaccgataccctgcaagcggaaaccgatcagctggaagatgaaaaaagcgcgctgcaaaccgaaattgcgaatctgctgaaagaaaaagaaaaactggaatttattctggcggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z