BBa_K243000 1 Fok_a Protein domain (active) of the restriction endonuclease FokI 2009-10-07T11:00:00Z 2015-05-08T01:11:37Z extract coding region of Fok from the restriction-modification genes of the chromosomal DNA of Flavobacterium okeanokoites. Part synthesized by Mr.Gene This part is used as the active domain of our universal restriction endonuclease. It cut double stranded DNA, when it fused with the inactive protein domain of our universal restriction endonuclease(BBa_K243001). false false _352_ 0 4732 9 It's complicated true Modifications of the vector (catalytic active heterodimer) -heterodimeric aminio acids * switch Glutamate 490/310-312 to Lysin (GAA->AAA) * switch isoleucin 538/454-456 to Lysin (ATC->AAA) false Freiburg Bioware09 annotation2041869 1 Fok_a range2041869 1 1 579 BBa_K157009 1 linker Split fluorophore linker; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 Originally, this linker was used for fusion to the N-terminus of the C-terminal half of split fluorophores: Protein interactions can be examined by BiFC[1] using complementary, non-fluorescent fragments of fluorophores[2]. Therefore, it is essential that the C-terminal fragment of the fluorophore is not restricted too much in its mobility. The linker allows orientation and adaption of the C-terminal fragment to the N-terminal fragment of the split fluorophore and, thus, the reassembly of a working fluorescent protein. It has already been used in BiFC assays and is known to serve this purpose well[3]; anyway, another, more flexible linker that could be used instead is our ???GGGGS-linker??? (Part Bba_K157010).References see "Part Design". false false _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. false iGEM Team Freiburg 2008 annotation2040643 1 Split-Fluorophore Linker range2040643 1 1 51 BBa_K243028 1 BBa_K243028 FOS-Split Linker-Fok_a 2009-10-18T11:00:00Z 2015-05-08T01:11:37Z Combined by serial cloning steps. we fused Splitli-Fok_a with Fos, linked to an His-tag. In a mixture of the expressed protein with Jun and Fok_i and the target DNA simultaneously the dimerization of Fos-Splitli-Fok_a with Jun should lead to the interaction of Fos-Splitli-Fok_a with the DNA. After binding and hence activation of the Fok_i and Fok_a partners, the DNA should be cutted. As a prospect the additional feature of photo-switchability of Fos can be generated, allowing regulation of the enzyme???s activity. Introduction of cysteine residues as reactive sites into Fos and fusion of thiol-reactive cross-linkers to them results in intramolecular cross-linking of the Fos protein. By a photo-switch between cis and trans conformations these cross-linkers can change their end to end distance. Thus isomerization can be used to promote helix folding or unfolding of Fos (Woolley et al., Bioinformatics Advance Access published October 17, 2006). false false _352_ 0 4732 9 It's complicated false none. false Freiburg Bioware09 component2052884 1 BBa_B0105 component2052882 1 BBa_K243027 component2052890 1 BBa_K243000 component2052888 1 BBa_B0105 component2052886 1 BBa_K157009 annotation2052888 1 BBa_B0105 range2052888 1 274 279 annotation2052886 1 BBa_K157009 range2052886 1 223 273 annotation2052884 1 BBa_B0105 range2052884 1 217 222 annotation2052890 1 BBa_K243000 range2052890 1 280 858 annotation2052882 1 BBa_K243027 range2052882 1 1 216 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K243027 1 Fos His-FOS 2009-10-18T11:00:00Z 2015-05-08T01:11:37Z Ordered by Mr.gene. The heterodimeric Fos complex is a transcriptional activator involved in the signal transduction pathway. Via leucin zipper they interact among each other and with their bipartite domain, rich of basic amino acids, they bind DNA (Abate et al., Mol Cell Biol. 1991 July). false false _352_ 0 4732 9 It's complicated false none. false Freiburg Bioware09 annotation2061297 1 Fos range2061297 1 1 216 BBa_B0105_sequence 1 accggc BBa_K243027_sequence 1 catcatcatcatcatcatggatccggagaagaaaaacgtcgtattcgtcgtgaacgtaataaaatggcggcggcgaaaagccgtaatcgtcgtcgtgaactgaccgataccctgcaagcggaaaccgatcagctggaagatgaaaaaagcgcgctgcaaaccgaaattgcgaatctgctgaaagaaaaagaaaaactggaatttattctggcggcg BBa_K243028_sequence 1 catcatcatcatcatcatggatccggagaagaaaaacgtcgtattcgtcgtgaacgtaataaaatggcggcggcgaaaagccgtaatcgtcgtcgtgaactgaccgataccctgcaagcggaaaccgatcagctggaagatgaaaaaagcgcgctgcaaaccgaaattgcgaatctgctgaaagaaaaagaaaaactggaatttattctggcggcgaccggccgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcacaccggcaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K243000_sequence 1 aaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatagcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt BBa_K157009_sequence 1 cgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z