BBa_K248000 1 BBa_K248000 phoA (alkaline phosphatase) promoter 2009-10-15T11:00:00Z 2015-05-08T01:11:40Z This part comes from the genome of a DH5a strain of E. coli. This part consists in the promoter of the alkaline phosphatase of Escherichia coli. It contains the phoB box sequence (ctgtcataaagttgtcacggcc), recognized by the phosphorilated transcriptional regulator phoB and activated under low extracellular phosphate concentrations. false false _341_ 0 5422 9 Not in stock false The main problem of this part is its short length: only 91 bp because it is the space between the end of the previous ORF and the beginning of the encoding region of PhoA. false Marina Badia Fabregat annotation2046024 1 phoA range2046024 1 1 90 BBa_K248000_sequence 1 ttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttgtttttattttttaatgtatttgtacatggagaaaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z