BBa_K248002 1 BBa_K248002 nirK (nitrite reductase) 2009-10-15T11:00:00Z 2015-05-08T01:11:40Z PCR from Nitrosomonas europaea (ATCC 19718). This part is the promoter region of the nirK gene of Nitrosomonas europaea (ATCC 19718). The transcription of the ORF following this region is activated by the transcriptional regulatory factor nsrR (BBa_K248001). false false _341_ 0 5422 9 Not in stock false none false Marina Badia Fabregat annotation2047306 1 nirK range2047306 1 1 312 BBa_K248002_sequence 1 gttgcgcgaaataccgtaacaatccgcaatttccgtaatggtggacaattcctctcttttcaaaccgagataagtgaggatgcgtaacgcgtaatcgctgtaattcgtcagtctcatgaagtattacccatttattgagtgggggttaacaagtatatccccacttttttatttctgcccgactggttgacaatctgaatcgaacgggtaaaatccatcaaaagatatattaataatatatctttaagaggaggtggttaatgatcaccgaagaagttaaatatgactgtatttaaaggtctttcgtgcaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z