BBa_K257006 1 SS_ompA ompA sequence signal 2009-08-19T11:00:00Z 2015-05-08T01:11:41Z genomic DNA (K12) To adress protein of interest in the membrane, the signal sequenced of ompA is a good candidat false true _354_ 0 5011 9 It's complicated false .. false Guillaume Cambray BBa_K257006_sequence 1 atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z