BBa_K258001 1 BBa_K258001 Lipase ABC transporter recognition domain (LARD 1) 2009-10-02T11:00:00Z 2015-05-08T01:11:42Z LARD 1 composed of residues 303-476 of thermostable lipase (TliA) of Pseudomonas fluorescens. Lard 1 was designed for the secretion of fusion proteins.The LARD 1 included four glycine-rich repeats comprising a β-roll structure, and were added to the C-terminus of test proteins. Either Pro-Gly linker or Factor Xa site can be added between fusion proteins and LARD 1. Upon supplementation of E. coli with ABC transporter from E. chrysanthemi (ABC transporter PrtDEF), which function well in the phylogenetically-neighboring genus E.coli, EGF-LARDs were excreted into the culture supernatant. false false _358_ 0 4260 9 It's complicated true In our designed LARD 1, we favoured not to add these cleavage site so if you want, yo can add either Pro-Gly linker or Factor Xa site. Secretion of fusion proteins with LARDs could be detected by Western blotting. Fusion proteins were traced in the culture supernatant using antibody against LARDs. Polyclonal antibodies against the C-terminal signal sequence were produced with a synthetic peptide (YQPTDRLVFQGADGST, residues 421???436 of TliA ,also of LARD). false Jung Hoon Ahn from Korea Advanced Institute of Science and Technology BBa_K258001_sequence 1 agcattgccaacctgtccacatgggtgtcacatctgccttcagcctatggtgatggtatgactcgtgtgctggaatctggcttttatgagcaaatgactcgtgatagtacgattattgtcgctaacctgtctgatccggctcgtgccaacacttgggttcaagacctgaaccgtaatgctgaacctcatacgggtaacacctttatcattgggtccgatgggaacgatctgattcaaggcggcaaaggagcggatttcatcgagggtggaaaaggcaacgacaccatccgtgacaattctgggcataacacgtttctgttttcgggccattttggtcaggatcgtatcatcggctatcagccgaccgatcgtctggtgtttcaaggtgctgatggttcaaccgatctgcgtgatcatgccaaagcagttggtgccgacacagttctgtcttttggagctgactcagtgactctggtgggagttggtctgggtggtctgtggtctgagggtgtactgattagctactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z