BBa_K258002 1 BBa_K258002 Granulysin, a T Cell Product,Kills Bacteria by Altering Membrane Permeability 2009-10-02T11:00:00Z 2016-02-01T12:59:26Z Granulysin is a member of the saposin-like protein (SAPLIP) family. The gene was synthesized at GENEART in pMA vector Granulysin, a protein located in the acidic granules of human NK cells and cytotoxic T cells, has microbial activity against a broad spectrum of microbial pathogens. The substance released by cytotoxic T cells (CD8) when attached to infected body cells. It creates holes in the target cell membrane and destroy it. That is,Granulysin induces apoptosis in target cells and have antimicrobial action. It is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of granulysin are potential antibiotics. Granulysin increased the permeability of bacterial membranes, as judged by its ability to allow access of cytosolic ??-galactosidase to its impermeant substrate.Granulysin functions to create holes in the target cell membrane and destroy it. Granulysin is able to induce apoptosis in target cells and also has antimicrobial action. false true _358_ 4206 4260 9 It's complicated true Granulysin can be purified via nickel affinity chromatography. false Ozkan IS BBa_K258002_sequence 1 atggcaacatgggctctgctgctgctggctgctatgctgctgggtaatcctggtctggttttctctcgtctgtctcctgagtattatgatctggcccgtgctcacctgcgtgatgaggaaaaatcttgtccttgcctggcacaggaaggtccacagggcgacctgctgacaaaaacacaggaactgggccgtgattatcgtacatgtctgaccgttcagaaactgaaaaaaatggtggataaaccgacacaacgttccgttagcaatgccgctacacgtgtctgtcgtaccggtcgttctcgttggcgtgacgtttgccgtaactttatgcgtcgctatcagtctcgtgttacacaaggcctggttgctggtgaaacagcacaacagtgtgaggatctgcgtctgtgtccatcaactggtcctctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z